© Benaki Phytopathological Institute
Salicylic acid expression at barley–
Pyrenophora teres
interaction
73
manufacturer’s instructions. RNA was used
for cDNA synthesis with the QuantiTect Re-
verse Transcription Kit (Qiagen) following
the manufacturer’s instructions and the re-
sulting cDNA was stored at −20°C. At the
same time points, samples from mock inoc-
ulated plants were collected as controls.
Semi quantitative RT-PCR
PCR primers for
PR2
were designed
based on the cDNA sequences of barley
available at NCBI
gov) database (Id:M23548.1) using Primer 3
software (5’ CAGCGAATGCTCCAATGAAGA
3’ and 5’ TACCCTGCCGTGAACATCAAG 3’).
PCR reactions were performed in a 50-μL fi-
nal volume including 1μL of ten times dilut-
ed cDNA template, 5 μL of 10X amplification
buffer (Thermo Scientific, USA), 1 μL of 200
μM deoxynucleotide triphosphates (Ther-
mo Scientific, USA), 1 μL of 10 pico-molar of
each primer, 0.2 μL (1 U) of Taq DNA poly-
merase (MBI Fermentas, York, UK) and 40.8
μL of PCR grade water. PCR reactions were
performed on a thermocycler (Biometra)
with the following program: an initial de-
naturing step at 94°C for 4 min, followed by
30 cycles of 94°C for 30 s, 57°C for 30 s, 72°C
for 1 min with a final extension at 72°C for
10 min. PCR products were separated using
1% agarose gels, stained with ethidium bro-
mide and observed on a UV transillumina-
tor. PCR was performed three times for each
primer using the same cDNA sample in or-
der to confirm the reproducibility of the re-
sults.
qRT-PCR assay
Quantitative real-time PCR (qPCR) was
performed using the method described by
Derveaux
et al.
(2010). Data was checked by
qRT-PCR dissociation curve analysis using
stepone software (v2.3). The fluorescence
readings of six replicated samples were av-
eraged and the blank value (without DNA
control) was subtracted.
PR2
relative expres-
sion levels were determined using the aver-
age cycle threshold (CT). Average CT values
were calculated from the triplicate exper-
iment conducted for each gene, with the
ΔCT value determined by subtracting the
average CT value of genes from the CT val-
ue of
EF1α
gene. Finally, the equation 2
-ΔΔCT
was used to estimate
PR2
relative expression
level (Livak and Schmittgen, 2001). Standard
deviation was calculated from the replicat-
ed experimental data. The statistical analy-
sis was conducted through the Tukey’s test
at the 0.05 level. The assumption of coinci-
dence was tested using the ANOVA proce-
dure implemented in the software package
Statistica 6.1.
Results and Discussion
In this study, we used two barley genotypes
with different resistance to
P. teres
infection.
As shown in Figure 1,
P. teres
produced net-
like striated lesions surrounded by chloro-
sis or necrosis, and these symptoms were
more severe on the susceptible genotype
‘WI2291’ after 10 days of infection. These
results are in agreement with our previous
observations under natural field conditions
(Arabi
et al.,
2003).
Further studies of barley-
P. teres
inter-
actions by measuring changes in the leaf
SA content and
PR2
gene expression at four
early time points after pathogen challenge
,
showed that SA levels of infected barley
leaves increased 24hpi in comparison with
non-inoculated plants (
Fig. 2
). With or with-
out pathogen pretreatment, the tolerant
genotype Banteng contained three-fold or
greater total SA than the susceptible geno-
type WI2291 (24hpi). It was found that Ban-
teng contained significantly (P=0.001) high-
er levels of total SA thanWI2291 a teach time
point investigated (
Fig. 2)
, which might re-
flect the expected role of SA in signaling
events during
P. teres
infection. This result
could support the findings published by
Häffner
et al.
(2014), stating that the endog-
enous SA level in a plant is the main cause
of susceptibility
versus
resistance in barley,
since pathogen infection may induce plant
responses regulated by SA. In addition, SA
accumulation has been widely used as a re-
liable marker of elevated defense responses
